View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11810_low_21 (Length: 239)
Name: NF11810_low_21
Description: NF11810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11810_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 108 - 224
Target Start/End: Complemental strand, 53592900 - 53592784
Alignment:
| Q |
108 |
gaaggaaatgaaaccatgtgtgcttatgaatgattgtagtaaaggaggtgagttatggtgatgagttgttagagaggttgagatgatatgttaaatgttg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53592900 |
gaaggaaatgaaaccatgtgtgcttatgaatgattttagtaaaggaggtgagttatggtaatgagttgttagagaggttgagatgatatgttaaatgttg |
53592801 |
T |
|
| Q |
208 |
gaacttatggtggtttt |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
53592800 |
aaacttatggtggtttt |
53592784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University