View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11811_high_13 (Length: 339)
Name: NF11811_high_13
Description: NF11811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11811_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 32041857 - 32041715
Alignment:
| Q |
17 |
ctgaggatttaagcacttcagatatgaatgatctcacatatgtggttgatgagaaaatgaaggaaattaatatgaagatggtgcaattggagaaggatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32041857 |
ctgaggatttaagcacttcagatatgaatgatctcacatatgtggttgatgagaaaatgaaggaaattaatatgaagatggtgcaattggagaaggatga |
32041758 |
T |
 |
| Q |
117 |
caggtcttagggcatgtgagtggtagtagctacaaaataagtc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32041757 |
gaggtcttagggcatgtgagtggtagtagctacaaaataagtc |
32041715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 183 - 322
Target Start/End: Complemental strand, 32041692 - 32041553
Alignment:
| Q |
183 |
aatgttgggtgtggggtttggtgatgtcaatctccaaaagtgtctttcaagatgttgggtgtagtttttcttttggggggatattttgttcttgattaaa |
282 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32041692 |
aatgttgggtgtgggatttggtgatgtcaatctccaaaagtgtctttcaagatgttgggtgtagtttttcttttgggggaatattttgttcttgattaaa |
32041593 |
T |
 |
| Q |
283 |
ggttttagggttctcagtatttcaatatcttgatgtttga |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32041592 |
ggttttagggttctcagtatttcaatatcttgatgtttga |
32041553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University