View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11811_low_14 (Length: 354)
Name: NF11811_low_14
Description: NF11811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11811_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 20 - 344
Target Start/End: Complemental strand, 30077665 - 30077344
Alignment:
| Q |
20 |
tagttagagatcaaactagggtaatattttaatgattaggtttaatatggggaagaatgatatttctatttggttttatatatgcaagggaaatgggaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30077665 |
tagttagagatcaaactagggtaatattttaatgattaggtttaatatggggaagaatgatatttctatttggttttatatatgcaag---aatgggaag |
30077569 |
T |
|
| Q |
120 |
gnnnnnnnnttgttagtgttaggtgtttaattatatgtaatttttcatagggatgtgttgattagtatttcatatataagatcaattcaattcaagtaaa |
219 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30077568 |
gaaaaaaa-ttgttagtgttaggtgtttaattatatgtaatttttcatagggatgtgttgattagtatttcatatataagatcaattcaattcaagtaaa |
30077470 |
T |
|
| Q |
220 |
tgttgttttctactttatgaaattgttcgttta-ttgttgtacaaaaactttgtctaacaccactatagcgacattagtgtagttcatgggagtgagatt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30077469 |
tgttgttttctactttatgaaattgttcgtttatttgttgtacaaattttttgtctaacaccactatagcgacattagtgtagttcatgggagtgagatt |
30077370 |
T |
|
| Q |
319 |
attcttactaccccaattgccctatg |
344 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30077369 |
attcttactaccccaattgccctatg |
30077344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University