View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11811_low_25 (Length: 255)
Name: NF11811_low_25
Description: NF11811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11811_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 49 - 235
Target Start/End: Complemental strand, 55068274 - 55068089
Alignment:
| Q |
49 |
gatcaatctagataccaacaaatgaagacaaaagagctattattataggcnnnnnnnntcaaataaaatcactccattgaaggtctctttttatacttgg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55068274 |
gatcaatctagataccaacaaatgaagacaaaagagctattattataggcaaaaaaa-tcaaataaaatcactccattgaaggtctctttgtatacttgg |
55068176 |
T |
|
| Q |
149 |
cgttttataaataccaggttaccaaaaaaggagaatttacacaggtgtggtatttctttagatgataattctcattattgtgtgaat |
235 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55068175 |
cgttttctaaataccaggttaccaaaaaaggagaatttacacaggtgtggtatttctttagatgataattctcattattgtgtgaat |
55068089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 55068335 - 55068293
Alignment:
| Q |
15 |
aagtagaaatccaatgtgttaataacaaatgctagatcaatct |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55068335 |
aagtagaaatccaatgtgttaataacaaatgctaaatcaatct |
55068293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 81
Target Start/End: Complemental strand, 55071518 - 55071486
Alignment:
| Q |
49 |
gatcaatctagataccaacaaatgaagacaaaa |
81 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
55071518 |
gatcaatctggataccaacaaatgaagacaaaa |
55071486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University