View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11811_low_31 (Length: 240)
Name: NF11811_low_31
Description: NF11811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11811_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 20 - 106
Target Start/End: Original strand, 41873182 - 41873268
Alignment:
| Q |
20 |
gttgccacatagcaagcaatttcggtaagaatttaaatttactatagcgttctttgtgatgacatttttgctgataacctagtgaca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41873182 |
gttgccacatagcaagcaatttcggtaagaatttaaatttactatagcgttctttgtgatgacatttttgctgataacctagtgaca |
41873268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 223
Target Start/End: Original strand, 41873351 - 41873381
Alignment:
| Q |
193 |
ctagttggagtcaaattcacttatttgatgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41873351 |
ctagttggagtcaaattcacttatttgatgt |
41873381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University