View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11812_low_7 (Length: 272)
Name: NF11812_low_7
Description: NF11812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11812_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 3 - 253
Target Start/End: Original strand, 34063639 - 34063888
Alignment:
| Q |
3 |
atgaggtatggtctaaacattaatctgaccaaaattttaggacagtttacacttcaagaaaatagttgttttaacagggaaaattgtgagtggcataaac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34063639 |
atgaggtatggtctaaacattaatctgaccaaaattttaggacagtttacacttcaagaaaagagttgttttaacatggaaaattgtgagtggcataaac |
34063738 |
T |
 |
| Q |
103 |
ccctaaaatatattgtgctttttcgaagggtaaatccctcagataccccagggatttcacaggggtttatccctcgctaaaattatgaacccctaacaaa |
202 |
Q |
| |
|
|| ||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34063739 |
cc-taaaaaatattgtgctttttcgaagggaaaatccctcagataccccagggttttcacacgggtttattcctcgctaaaattatgaacccctaacaaa |
34063837 |
T |
 |
| Q |
203 |
tgattaggtagaaaacaataatctattaaattttgaatttagctgtcacac |
253 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| ||||||||| |
|
|
| T |
34063838 |
tgattaggtagaaattagtaatctattaaattttgaatttatctgtcacac |
34063888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University