View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11813_high_40 (Length: 254)

Name: NF11813_high_40
Description: NF11813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11813_high_40
NF11813_high_40
[»] chr8 (1 HSPs)
chr8 (10-254)||(5412993-5413233)


Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 10 - 254
Target Start/End: Original strand, 5412993 - 5413233
Alignment:
10 agatgaaaagaagcataatggtcactcacaaaatcttgattttcttttaatnnnnnnnnnnnntgttattctaactttagactaggccattaggagccat 109  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||            |||||||||||||||||||||||||||||||||||||    
5412993 agatgaaaagaagcataatggtcactcgcaaaatcttgattttcttttaataaaaaaaaaaaatgttattctaactttagactaggccattaggagccat 5413092  T
110 ctgcataacttttgacacgcaaatttagcatcaaattcgacaacaatatagaaggttaaacaattcgtatgcgattaattatcttaacgagatggttaac 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||      
5413093 ctgcataacttttgacacgcaaatttagcatcaaattcgacaacaatatagaaggttaaacaattcgtatgcgattaattatctaaacgagatggtta-- 5413190  T
210 acacacacatataccgtcaattgttgtaaagcaagagggcattct 254  Q
      ||||||||||||||||||||||||||||||| |||||||||||    
5413191 --acacacatataccgtcaattgttgtaaagcaggagggcattct 5413233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University