View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11813_low_26 (Length: 379)
Name: NF11813_low_26
Description: NF11813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11813_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 4e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 180 - 353
Target Start/End: Original strand, 45310518 - 45310691
Alignment:
| Q |
180 |
atactatgatagcaactactactactgagttttatctcattaggtagggtcatgatatgatcacacaatgttgattttctatcataatggttgaatagct |
279 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310518 |
atactatggtagcaactactactactgagttttatctcattaggtagggtcatgatatgatcacacaatgttgattttctatcataatggttgaatagct |
45310617 |
T |
|
| Q |
280 |
aaagctaactttaagtatagactacatgaatgaatttgctggtccatgagaaattcgacgtcggtgaactcaac |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310618 |
aaagctaactttaagtatagactacatgaatgaatttgctggtccatgagaaattcgacgtcggtgaactcaac |
45310691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 45310404 - 45310520
Alignment:
| Q |
1 |
cctttttgccagtcatacttaaagagaaatgtgacattcgtttttattcattagttaatgtgcgtttaataaagctggnnnnnnnnnntcatactaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
45310404 |
cctttttgccagtcatacttaaagagaaatgtgacattcgtttttattcattagttaatgtgcgtttaataaagctgg-aaaaaaaaatcatactaatca |
45310502 |
T |
|
| Q |
101 |
gtttatttaaaacatata |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45310503 |
gtttatttaaaacatata |
45310520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University