View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11813_low_30 (Length: 344)
Name: NF11813_low_30
Description: NF11813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11813_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 7724492 - 7724155
Alignment:
| Q |
1 |
agtgattctaaacattggcattggatttggaccatcagatttgcttcaaaccaattaaatccaatccaccatcagtactgtacatacctatcagtattcg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7724492 |
agtgattctaaacaatggcattggatttggaccatcagatttgcttcaaaccaattaaatccaatccaccatcagtactgtacatacctatctgtattcg |
7724393 |
T |
 |
| Q |
101 |
tgtatatgaacgtgtgtggtatggaattcagcaaaaatatatataaataaaaacaacaaatatgtatagtatttcatgcacactatagacttgcaattga |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724392 |
tgtatatgaacgtgtgtggtgtggaattcagcaaaaatatatataaataaaaacaacaaatatgtatagtatttcatgcacactatagacttgcaattga |
7724293 |
T |
 |
| Q |
201 |
gatagtgtatatgcaagtctttgtnnnnnnnnnnnngaagtaggttgttatacatctaactgaaagagaaagttaattaaagtagtcgatnnnnnnnnnn |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724292 |
gatagtgtatatgcaagtctttgtgaaaaaaa-----aagtaggttgttatacatctaactgaaagagaaagttaattaaagtagtcgataaaaaataaa |
7724198 |
T |
 |
| Q |
301 |
nngacaaactaagaatatagaattatctcacattctcactcca |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724197 |
aagacaaactaagaatatagaattatctcacattctcactcca |
7724155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University