View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11813_low_43 (Length: 252)
Name: NF11813_low_43
Description: NF11813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11813_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 3641104 - 3641204
Alignment:
| Q |
1 |
aggactttgatgggagctattgtagttgaagaaaaggccacgatatcacgtcacctgaagtcctgtgctttggagcgggatattcctattatggtaagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3641104 |
aggactttgatgggagctattgtagttgaagaaaaggccacgatatcacgtcacctgaagtcctgtgctttggagcgggatattcctattatggtaagta |
3641203 |
T |
 |
| Q |
101 |
g |
101 |
Q |
| |
|
| |
|
|
| T |
3641204 |
g |
3641204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 150 - 233
Target Start/End: Original strand, 3641254 - 3641337
Alignment:
| Q |
150 |
gtaccaggaagaatgttattggtcgtgcattagcatgcttgagaattctgctctttataatgaatctctcatatgagagtgagg |
233 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3641254 |
gtaccaggaagaatgctattggtcgtgcattagcatgcttgagaattctgctctttataatgaatctctcatatgagagtgagg |
3641337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University