View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11813_low_48 (Length: 248)
Name: NF11813_low_48
Description: NF11813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11813_low_48 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 248
Target Start/End: Original strand, 10575962 - 10576196
Alignment:
| Q |
14 |
gacatcatgaactattgtaagctattaagttctgtgttgaatattgcatctgtgattaacataatcaccataaattatgttaatcagaacgtcttgtcct |
113 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10575962 |
gacatcatgaactattgtacgctattaagttctgtgttcaatattgcatctgtgattaacataatcaccataaattatgttaatcagaacttcttgtccc |
10576061 |
T |
 |
| Q |
114 |
aacgaagacccacatttttatagtgggtagctcttgccatgctatcttcatcataaattttgcatttattcacaaggatagaaaaacattagcatctcct |
213 |
Q |
| |
|
|| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576062 |
aaagaagacccacattcttatagtgagtagctcttgccatgctatcttcatcataaattttgcatttattcacaaggatagaaaaacattagcatctcct |
10576161 |
T |
 |
| Q |
214 |
ggtggccaatgaattgcatatgcaccattatagtg |
248 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10576162 |
ggtggccaatgaattgcatatacaccattatagtg |
10576196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University