View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11813_low_53 (Length: 240)
Name: NF11813_low_53
Description: NF11813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11813_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 49158513 - 49158292
Alignment:
| Q |
1 |
tacattctaattaaaattatgtacacggatatgaaatatgaattacattctatttataatgtgatatatgatgcatatgcaattgtaggcaaactcagag |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158513 |
tacattctatttaaaattatgtacacggatatgaaatatgaattacattctatttataatgtgatatatgatgcatatgcaattgtaggcaaactcagag |
49158414 |
T |
 |
| Q |
101 |
gtgtctgcattgcttggtcgcatcccatctgccgttggttatcaaccaacattgtctactgatcttggaggtcttcaagagcgtattacaaccaccaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49158413 |
gtgtctgcattgcttggtcgcatcccatctgccgttggttatcaaccaacgttgtctactgatcttggaggtcttcaagagcgtattacaaccaccaaga |
49158314 |
T |
 |
| Q |
201 |
agggttcaattacctctgtcca |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49158313 |
agggttcaattacctctgtcca |
49158292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 59 - 222
Target Start/End: Complemental strand, 49153526 - 49153362
Alignment:
| Q |
59 |
atgtgatatatgatgcat-atgcaattgtaggcaaactcagaggtgtctgcattgcttggtcgcatcccatctgccgttggttatcaaccaacattgtct |
157 |
Q |
| |
|
|||||||||||||||| | ||| | ||||||| ||||||||||||||||| |||||||||| || |||||||| |||||||| ||||||||||||||| |
|
|
| T |
49153526 |
atgtgatatatgatgcctgatgtcactgtaggctaactcagaggtgtctgccctgcttggtcgtattccatctgcggttggttaccaaccaacattgtct |
49153427 |
T |
 |
| Q |
158 |
actgatcttggaggtcttcaagagcgtattacaaccaccaagaagggttcaattacctctgtcca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49153426 |
actgatcttggaggtcttcaagagcgtattacaaccaccaagaagggttcaattacatctgtcca |
49153362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 156
Target Start/End: Original strand, 27960569 - 27960615
Alignment:
| Q |
110 |
ttgcttggtcgcatcccatctgccgttggttatcaaccaacattgtc |
156 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||| |||| |
|
|
| T |
27960569 |
ttgcttggtcgtatcccatcggctgttggttatcaaccaacactgtc |
27960615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University