View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_high_27 (Length: 250)
Name: NF11814_high_27
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_high_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 48289128 - 48289371
Alignment:
| Q |
11 |
cagagatgtatgtgtgttgctgagcaacacaacagtgtgtattaatgaaaagaaaaggagtgcaccaaaacgacgtatgaagggcagaagttgtgttgag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48289128 |
cagagatgtatgtgtgttgctgagcaacacaacagtgtgtattaatgaaaagaaaaggagtacaccaaaacgacgtatgaagggcagaagttgtgttgag |
48289227 |
T |
 |
| Q |
111 |
taatagtggcagt----aaggaccacaactgacgagacgacagtcgaagttggtatttctgaacttaggctgcccactacccaacctgatagtgacttca |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48289228 |
taatagtggcagtgagtaaggaccacaactgacgagacgacagtcgaagttggcattcctgaacttaggctgcccactacccaacctgatagtgacttca |
48289327 |
T |
 |
| Q |
207 |
gctcccacattcaacacatgtcaacctcaggattcttggaccac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48289328 |
gctcccacattcaacacatgtcaacctcaggattcttggaccac |
48289371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University