View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_high_43 (Length: 202)
Name: NF11814_high_43
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 32 - 122
Target Start/End: Original strand, 30963910 - 30964001
Alignment:
| Q |
32 |
aatcttaactcaaccctttt-tgtcgtttaataaatatactttgatatgatgatattgatannnnnnnaataaatatactttgatattgaca |
122 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30963910 |
aatcttaactcaacccttttttgtcgtttaataaatatactttgatatgatgatattgatatttttttaataaatatactttgatattgaca |
30964001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 99 - 163
Target Start/End: Original strand, 30964855 - 30964919
Alignment:
| Q |
99 |
aataaatatactttgatattgacaaataaaactgagaatataattgatatcaaacccaacccctc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30964855 |
aataaatatactttgatattgacaaataaaactgagaatataattgatctcaaacccaacccctc |
30964919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University