View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_low_13 (Length: 353)
Name: NF11814_low_13
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 9e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 208 - 329
Target Start/End: Complemental strand, 19898193 - 19898070
Alignment:
| Q |
208 |
tatgtagagacgagactagagagagag--gaagatggatcaactcaatgacaatatatctgactcaaagtaagtaaaaggcaaaaggaatgagagagact |
305 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19898193 |
tatgtagagacgagactagagagagagaggaagatggatgaactcaatgacaatatatctgactcaaagtaagtaaaaggcaaaaggaatgagagagact |
19898094 |
T |
|
| Q |
306 |
tgaacgtgataggttggttgaaga |
329 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
19898093 |
tgaacgtgataggttggttgaaga |
19898070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 60 - 130
Target Start/End: Complemental strand, 19899144 - 19899074
Alignment:
| Q |
60 |
tcgtaagactagacttgtagatagatggtaacgatggtgagtaaattcagcacgtatgagggaacaactac |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19899144 |
tcgtaagactagacttgtagatagatggtaacgatggtgagtaaattcagcacgtatgagggaacaactac |
19899074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 127 - 179
Target Start/End: Complemental strand, 19898242 - 19898192
Alignment:
| Q |
127 |
ctacatggtcttgactgcagttaaaactgtatgagtattgagtatgatccgta |
179 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19898242 |
ctacatggtcttgactgcagttaaaac--tatgagtattgagtatgatccgta |
19898192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 61
Target Start/End: Complemental strand, 11564930 - 11564893
Alignment:
| Q |
24 |
aaagttttcacaaaataaatattcaaatatcatttatc |
61 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
11564930 |
aaagttgtcacaaaataaatgttcaaatatcatttatc |
11564893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University