View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_low_21 (Length: 309)
Name: NF11814_low_21
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 244
Target Start/End: Complemental strand, 16749304 - 16749074
Alignment:
| Q |
14 |
gatgtccaagcatccatggaagattctgctagtaattcaatcatatcaagttttaagcaatttcgtgtattgaatcttaatcagatcatttcaaaaaaga |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
16749304 |
gatgtccaagcatccatggaagaatctgctagtaattcaatcatatcaagttttaagcaatttcgtgtattgaatcttaatcacatcattacaaaaaaga |
16749205 |
T |
|
| Q |
114 |
tcccatcttgcattggtatgctgaaacatctacgctatcttgatctttctcacaatgatcagattgaggtgcttccaaattcgataaccaagttaattaa |
213 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
16749204 |
tcccgtcttgcattggtatgctgaaatatctgcgctatcttgatctttctcacaatgaacagattgaggtgcttccaaattctataaccaaattaattaa |
16749105 |
T |
|
| Q |
214 |
cttactgactctcttactcaatgattgtttc |
244 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
16749104 |
cttagagactctcttactcaatgattgtttc |
16749074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University