View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_low_26 (Length: 250)
Name: NF11814_low_26
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 2525084 - 2524848
Alignment:
| Q |
1 |
ctatttataagaaataaaattcattttaaaattggacatgtatgttgatcatggctataaaatgcatttttgatttgatatttgtactaccttcttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2525084 |
ctatttataagaaataaaattcattttaaaattggacatgtatgttgatcatggctataaaatgcatttttgatttgatatttgtactgccttcttttat |
2524985 |
T |
 |
| Q |
101 |
aaacaaagatatgttatagagattatgatggatacttgaacccaatacaaatatttgaatcaaagatgtctttc-atgcacattacatgcatgtttagaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
2524984 |
aaacaaagatatgttatagagattatgatggatacttgaacccaataaaaatatttgaatcaaagatgtctttcaatgcacatta----catgtttagaa |
2524889 |
T |
 |
| Q |
200 |
caccaatcaacaaaactataacataacttccttgccctatg |
240 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2524888 |
caccgatcaacaaaactataacataacttccttgccctatg |
2524848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University