View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_low_29 (Length: 248)
Name: NF11814_low_29
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 41880574 - 41880405
Alignment:
| Q |
1 |
acacaatctagatcataaaattaatttttaaaaacaattttcgttggacaaatgtcggaaacagnnnnnnnattaatcaagttttaaattatttaaattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41880574 |
acacaatctagatcataaaattaatttttaaaaacaattttcgtttgacaaatgtcggaaacagtttttttattaatcaagttttaaattatttaaattg |
41880475 |
T |
 |
| Q |
101 |
gttgagaatgaaacttgcctgccattaaaaattgagacattcacattgtcaacacatttgtggttgttcgattgagatcgaacactc |
187 |
Q |
| |
|
|| ||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41880474 |
gtcgagaatg-----------------aaaattgagccattcacattgtcaacgcatttgtggttgttcgattgagatcgaacactc |
41880405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University