View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_low_32 (Length: 244)
Name: NF11814_low_32
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 41880639 - 41880870
Alignment:
| Q |
1 |
tgatggactctacctattttattttaacctttagctgccag-aaagaaggcaacttgtctatgatcaatatataagatagatatt------ttctaacat |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41880639 |
tgatggactctacctattttattttaacctttagctgccagcaaagaaggcaacttgtctatgatcaatatataagatagatattgatactttctaacat |
41880738 |
T |
 |
| Q |
94 |
tttcacttaaaagataaatcaagaagtgtaacatttaaaaaacgactactcataattagaggtgtcaaataggttggctcgatccaacctagactcgaga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||||||| ||||| ||| ||||||||| |
|
|
| T |
41880739 |
tttcacttaaaagataaatcaagaagtgtaacatttaaaaaaggactactcataattagaggtgtcgaatgggttggctcaatccagcctggactcgaga |
41880838 |
T |
 |
| Q |
194 |
ggtccgactatataaatggtcagtatggccca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41880839 |
ggtccgactatataaatggtcagtatggccca |
41880870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University