View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_low_33 (Length: 243)
Name: NF11814_low_33
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 243134 - 242939
Alignment:
| Q |
1 |
cccccacagtaatcgattcccaaataagtggctaatatattaattcatattgaggacaaattaattaat------------ccctctcttataattgatt |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
243134 |
cccccacagtaatcgattcccaaataagtggctaatatattaattcatattgaggacaaattaattaattaattaattaatccctctcttataattgatt |
243035 |
T |
|
| Q |
89 |
gtgagagaccagaccaaattggttgttgagtaaaaatataa----aacatgaacaatgagcaagtcttaattaatataataactaacaacttacca |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
243034 |
gtgagagaccagaccaaattggttgttgagtaaaaaaataaagagaacatgaacaatgagcaagtcttaattaatataataactaacaacttacca |
242939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University