View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_low_34 (Length: 242)
Name: NF11814_low_34
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 19901117 - 19901332
Alignment:
| Q |
1 |
tttgtcgcataaggctcaggaatagaatcagaatgtgtaggttgttcgtttgcaatgatttttacctcacatgattcagcttgtaccgtgccatgttctg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19901117 |
tttgtcgcataaggcccaggaatagaatcagaatgtgtaggttgttcgtttgcaatgatttttacctcacatgattcagcttgtaccgtgccatgttctg |
19901216 |
T |
 |
| Q |
101 |
taggtgcatattgtgaatacctattgctgaacgataggaatgtcaacattcagtgtctcgaatgccttagatgagccgatgcttaaaggattctcttttg |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||| | |||||||||||||||| ||||||||||||||| |
|
|
| T |
19901217 |
taggtgcatattgtg-atacctattgctgaacgataggaatgtcaacattcagtctctcaaatgcatcagatgagccgatgcttgaaggattctcttttg |
19901315 |
T |
 |
| Q |
201 |
tcagccaaccttgcaat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
19901316 |
tcagccaaccttgcaat |
19901332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University