View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11814_low_38 (Length: 238)
Name: NF11814_low_38
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11814_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 4112140 - 4111922
Alignment:
| Q |
1 |
ttccaccacgaatgttctatacaaatcatagtcataaatacaagttattactatatccatcataagaggacaatattaaacaaacctagcttaacatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4112140 |
ttccaccacgaatgttctatacaaatcatagtcataaatacaagttattactatatccatcataagaggacaatattaaacaaacctagcttaacatatt |
4112041 |
T |
 |
| Q |
101 |
gtaatgattttagaggtctttgtaaaaataacatcaagataaaagcatgtacacatatcctcgtaaaaattcaagctattatactaaagatctaaagaat |
200 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4112040 |
gtaatgattttagagatcttagtaaaaataacatcaagataaaagcatgtacaca-atcctcgtaaaaattcaagctattatactaaagatctaaagaat |
4111942 |
T |
 |
| Q |
201 |
catgcttgctttaccgtgtt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4111941 |
catgcttgctttaccgtgtt |
4111922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University