View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11814_low_43 (Length: 202)

Name: NF11814_low_43
Description: NF11814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11814_low_43
NF11814_low_43
[»] chr5 (2 HSPs)
chr5 (32-122)||(30963910-30964001)
chr5 (99-163)||(30964855-30964919)


Alignment Details
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 32 - 122
Target Start/End: Original strand, 30963910 - 30964001
Alignment:
32 aatcttaactcaaccctttt-tgtcgtttaataaatatactttgatatgatgatattgatannnnnnnaataaatatactttgatattgaca 122  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||    
30963910 aatcttaactcaacccttttttgtcgtttaataaatatactttgatatgatgatattgatatttttttaataaatatactttgatattgaca 30964001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 99 - 163
Target Start/End: Original strand, 30964855 - 30964919
Alignment:
99 aataaatatactttgatattgacaaataaaactgagaatataattgatatcaaacccaacccctc 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
30964855 aataaatatactttgatattgacaaataaaactgagaatataattgatctcaaacccaacccctc 30964919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University