View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11815_high_4 (Length: 343)
Name: NF11815_high_4
Description: NF11815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11815_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 21436725 - 21436395
Alignment:
| Q |
1 |
ttgaggttgttgagagaaggtacttgcaaggataggacttcgtgtttggcggttataaaacagttggggaaaattcgacatgagaatttgattcctttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21436725 |
ttgaggttgttgagagaaggtacttgcaaggataggacttcgtgtttggcggttataaaacagttggggaaaattcgacatgagaatttgattcctttga |
21436626 |
T |
 |
| Q |
101 |
gagctttctatcaaggaaaaagaggggagaagctgcttatttatgattatctgcctctcagaactcttcatgatcttttgcatggtttgttgaatactta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21436625 |
gagctttctatcaaggaaaaagaggggagaagctgcttatttatgattatctgcctctcagaactcttcatgatcttttgcatggtttgttgaatactta |
21436526 |
T |
 |
| Q |
201 |
actctcttctaatgaatttgcnnnnnnnnnnnnnnnnctgtttcattcacatgcttatataagtagcatttcatatttataactgtcatcataatttcat |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21436525 |
actctcttctaatgaatttgctttttttgctttttg--tgtttcattcacatgcttatataagtagcatttcatatttataactgtcatcataatttcat |
21436428 |
T |
 |
| Q |
301 |
attcaaattctttttgtagtgtgttagtctctg |
333 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
21436427 |
attcaaattcgttttgtagtgtgttagtctctg |
21436395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University