View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11815_low_5 (Length: 331)
Name: NF11815_low_5
Description: NF11815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11815_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 5 - 317
Target Start/End: Original strand, 21466849 - 21467161
Alignment:
| Q |
5 |
tggtgattggaaatttgtgttttttatacagatggcgatggtcgctttaccgggactgaagccaccaaattttttgcaatgtcgaatttgtctcgacaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21466849 |
tggtgattggaaatttgtgttttttatacagatggcgatggtcgctttaccgggactgaagccaccaaattttttgcaatgtcgaatttgtctcgacaag |
21466948 |
T |
|
| Q |
105 |
agctcaagcaggtttcaannnnnnnnatttggcttgtgcattggaacaaggtgtctgtataaataggaataacgtatgtgttcattagggtggaaaccag |
204 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21466949 |
agctcaagcaggtttcaattttttttatttggcttgtgcattggaacaaggtgtctgtataaataggaataatgtatgtgttcattagggtggaaaccag |
21467048 |
T |
|
| Q |
205 |
taaattagtattttgaagtaaaggcttgtttcctttggtaaggcatctaaaatttgagtttttataatttaggtttattggaaaaaattagagtgcacat |
304 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21467049 |
tcaattagtattttgaagtaaaggcttgtttcctttggtaaggcatctcaaatttgagtttttataatttaggtttattggaaaaaattagagtgcacat |
21467148 |
T |
|
| Q |
305 |
cgactagagatga |
317 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21467149 |
cgactagagatga |
21467161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University