View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11815_low_9 (Length: 235)
Name: NF11815_low_9
Description: NF11815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11815_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 93 - 218
Target Start/End: Original strand, 21436960 - 21437085
Alignment:
| Q |
93 |
gttttgcatataaccaatcaacaatgaagccaaaacaacagcacctgtcataagactaataacaataccagcaacagcaccagaactcaatgaagaattc |
192 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21436960 |
gttttgcatataaccaatcaacaaagaagccaaaacaacagcacctgtcataagactaataacaataccagcaacagcaccagaactcaatgaagaattc |
21437059 |
T |
 |
| Q |
193 |
ttactacaactttgcaaaggtgtacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21437060 |
ttactacaactttgcaaaggtgtacc |
21437085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University