View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11816_high_13 (Length: 303)
Name: NF11816_high_13
Description: NF11816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11816_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 273
Target Start/End: Original strand, 9019283 - 9019541
Alignment:
| Q |
18 |
attacagtgcagagttattattgagaatttacttgactgtgtatgcattttctgccagaataatattgaaacactaaccatctcttcttctaatgtttct |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9019283 |
attacagtgtagagttattattgagaatttacttgactgtgtatgcattttctgccagaataatattgaaacaccaaccatctcttcttctaatgtttct |
9019382 |
T |
 |
| Q |
118 |
tctcatattttgtatggtatgctattgcctatttataaatggttagg-ttttgaagggagtacaaaa-ttctatgttgtaaatcatttcgtccaattcga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9019383 |
tctcatattttgtatggtatgctattgcctatttataaatggttaggtttttgaagggagtacaaaatttctatgttgtaaatcatttcgtccaattcga |
9019482 |
T |
 |
| Q |
216 |
gtctctttttgaagggaagagaactatgaagatccgatac-tggtttggttatccacac |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
9019483 |
gtctctttttgaagggaagagaactatgaagatccgacacttggtttggttatccacac |
9019541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University