View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11816_high_16 (Length: 262)
Name: NF11816_high_16
Description: NF11816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11816_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 28 - 247
Target Start/End: Complemental strand, 26326668 - 26326447
Alignment:
| Q |
28 |
tcatgaaatttcttaaggaaaagaagattcttctt---ggaagtatctctccaagaccaagcaagctaggaaggtgcttgattatctatatataaactag |
124 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||| |||||||| |||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26326668 |
tcatgaaatttctaaaggaaaagaagattattcttattggaagtatatctctaagaccaagcaag----gaaggtgcttgattatctatatataaactag |
26326573 |
T |
|
| Q |
125 |
gggataatta---taggacttcactttttcatatttcaaggattattcttctgttatattaatactattgtcattttaggaaacctatgtttgcagcaaa |
221 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26326572 |
gggataattaatataggacttcactttttcatatttcaaggattattcttctgttatattaatactattgtcattttacgaaacctatgtttgcagcaaa |
26326473 |
T |
|
| Q |
222 |
gttacaagaaaagaatatgcttcatg |
247 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
26326472 |
gttacaagaaaagaatatgcttcatg |
26326447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University