View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11816_high_24 (Length: 228)
Name: NF11816_high_24
Description: NF11816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11816_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 34127838 - 34127918
Alignment:
| Q |
1 |
agttggtctttctgttttgctcgtctcaaattgaccaagtccttgttnnnnnnnttacaaaatgttggtctgatctgcata |
81 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
34127838 |
agttggtttttctgttttcctcgtctcaaattgaccaagtccttgttaaaaaaattacaaaaggttggtctgatctgcata |
34127918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 48558114 - 48558192
Alignment:
| Q |
1 |
agttggtctttctgttttgctcgtctcaaattgaccaagtccttgttnnnnnnnttacaaaatgttggtctgatctgcat |
80 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48558114 |
agttggtctttctgttttcctcgtctcaaattggccaagtccttgtt-ctaaaattacaaaatgttggtctgatctgcat |
48558192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University