View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11816_low_10 (Length: 322)
Name: NF11816_low_10
Description: NF11816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11816_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 113 - 283
Target Start/End: Original strand, 43414041 - 43414214
Alignment:
| Q |
113 |
tgctcctctcaggttgtaattcctgactgaccgcactcataattcatattagcaaggatcgaga---cttacaaaccgatatgtccaggggtttggaccc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
43414041 |
tgctcctctcaggttgtaattcctgactgaccgcactcataattcatattagcaaggatcgagaagacttacaaaacgatatgtccaggggtttggaccc |
43414140 |
T |
 |
| Q |
210 |
aaactgttcttacaccgggctgaaacataattagcaggaccaccaatcataattcaacaacaaaaaccaacaat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43414141 |
aaactgttcttacaccgggctgaaacataattagcaggaccatcaatcataattcaacaacaaaaaccaacaat |
43414214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 270
Target Start/End: Complemental strand, 13321746 - 13321702
Alignment:
| Q |
226 |
gggctgaaacataattagcaggaccaccaatcataattcaacaac |
270 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
13321746 |
gggctgaaacataatttacaggatcaccaatcataattcaacaac |
13321702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University