View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11816_low_14 (Length: 292)
Name: NF11816_low_14
Description: NF11816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11816_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 6626490 - 6626205
Alignment:
| Q |
1 |
aaatgccaacatctacggggcaaccacctcctgctttctttgatttatctgcatcaggcattgatggcgcctcttctccccatcaaagtcctggaggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6626490 |
aaatgccaacatctacggggcaaccacctcctgctttctttgatttatctgcgtcaggcattgatggtgcctcttctccccatcaaagtcctggaggaaa |
6626391 |
T |
 |
| Q |
101 |
aaaccccaaaagcccagctagatcttcttcacccctaccaaggttatcccttgactacccaacagctgcacgccgtgaaaggttatctctcgaataccca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6626390 |
aaaccccaaaagcccagctagatcttcttcacccctaccaaggttatcccttgactacccaacagctgcacgccgtgaaaggttatctcttgaataccca |
6626291 |
T |
 |
| Q |
201 |
acaactgcacctcctcccagtgttcaccccttacccttgcctccttggcctggaacttccttaccttcaccctctgcctatgctac |
286 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6626290 |
acaactgcacctcctcccagtgttcacccgttacccttgcctccttggcctggaacttccttaccttcaccctctgccaatgctac |
6626205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University