View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11816_low_19 (Length: 249)
Name: NF11816_low_19
Description: NF11816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11816_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 245
Target Start/End: Original strand, 47879113 - 47879351
Alignment:
| Q |
12 |
agagagctttggtttagactttcaacacagcatcacaggatacaaatcgcttttcactcaatgtctgccgccacaaatccaatggtacgtgctacctcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47879113 |
agagagctttggtttagactttcaacacagcatcacaggatacaaatcgcttttcactcaatgtctgccgccacaaatccaatggtacacgctacctcat |
47879212 |
T |
 |
| Q |
112 |
cgtcgtttactcgaatgttcttttcatttatctttctgtttaattttgaattggaattggaatgaatttaactgaactattattattgttgtgttcttaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47879213 |
cgtcgtttactcgaatgttcttttcatttatctttctgtttaattttgaattggaattggaatgaatttaactgaactattattattgttgtgttcttaa |
47879312 |
T |
 |
| Q |
212 |
ttatta-----ttggcgacgaagatgtccagcgataaca |
245 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
47879313 |
ttattattctcttggcgacgaagatgtccagcgataaca |
47879351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University