View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11816_low_20 (Length: 242)
Name: NF11816_low_20
Description: NF11816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11816_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 32644004 - 32643788
Alignment:
| Q |
7 |
tgagatgaacgttgtaacggtattagaagtctcgtctatcactaactgtttgtttgggggtaaataaaagatttatttacactttgtgaagtttcattat |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32644004 |
tgagatgaacgttgtaaccgtattagaagtctcgtctatcactaactgtttg----ggggtaaatataagatttatttacactttgtgaagtttcattat |
32643909 |
T |
 |
| Q |
107 |
gttattcgttgtccctaaaaatgatgtgttataggcgctttcacacaatgatttctcttacatattacagtttaaatgacataattttaaacgtggattt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32643908 |
gttattcgttgtccctaaaaatgatgtgttatatgcgctttcacacaatgatttctcttacatattacagtttaaatgacataattttaaacgtggattt |
32643809 |
T |
 |
| Q |
207 |
aactcacatgcagttacaatt |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32643808 |
aactcacatgcagttacaatt |
32643788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University