View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11816_low_23 (Length: 229)

Name: NF11816_low_23
Description: NF11816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11816_low_23
NF11816_low_23
[»] chr3 (1 HSPs)
chr3 (180-223)||(34128086-34128129)


Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 180 - 223
Target Start/End: Original strand, 34128086 - 34128129
Alignment:
180 aggagtccctagtgtcttgtcaatacataacatcaagaactaat 223  Q
    ||||||||||||||||||||||||||||||| ||||||||||||    
34128086 aggagtccctagtgtcttgtcaatacataacgtcaagaactaat 34128129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University