View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11817_low_20 (Length: 246)
Name: NF11817_low_20
Description: NF11817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11817_low_20 |
 |  |
|
| [»] scaffold0114 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0114 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold0114
Description:
Target: scaffold0114; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 5773 - 5986
Alignment:
| Q |
16 |
gacatcacaggtaagcaacataataaatcattctcagcctccgtaaccaatcttggaaccaattgctctaccatattattagccccacaatcattatcaa |
115 |
Q |
| |
|
||||||| |||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5773 |
gacatcataggtaaacgacataataaatcagtctcagcctccgtaaccaatcttggaaccaattgctctaccatattattagccccacaatcattatcaa |
5872 |
T |
 |
| Q |
116 |
cgctaaaaatagactgaaaatatgacacaacatggtcctctatctcaattgggtccgagatgacattatccccatcatgaagaatggacatatgtttaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5873 |
cgctaaaaatagactgaaaatatgacacaacatgctcctctatctcaattgggtccgagatgacattatccctatcatgaagaatggacatatgtttaga |
5972 |
T |
 |
| Q |
216 |
gaccgcacgtacct |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5973 |
aaccgcacgtacct |
5986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University