View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11818_high_19 (Length: 248)
Name: NF11818_high_19
Description: NF11818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11818_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 34250747 - 34250975
Alignment:
| Q |
1 |
ctttaggttccacttatagactattaaggaaaaattattgggttggccctgtgccaccaccaagccacgttattaccccctccagtcatacaatttcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34250747 |
ctttaggttccacttatagactattaaggaaaaattattgggttggccctgtgccac---caagccacgttattaccccctccagtcatacaatttcaaa |
34250843 |
T |
 |
| Q |
101 |
aatcaacttagatgttttatgtatcaactattgatgaattaatgactgatattatattttgatgcgtaactaatcataactgtgttgaatatctagaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || || | | || | |||| ||||||||||||| |
|
|
| T |
34250844 |
aatcaacttagatgttttatgtatcaactattgatgaattaatgactgatattataat----tgtgt---tcaatatgaggctgttcaatatctagaact |
34250936 |
T |
 |
| Q |
201 |
tgaccaacatgcacattggcccataattttttccctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34250937 |
tgaccaacatgcacattggcccataattttttcactttg |
34250975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University