View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11818_low_17 (Length: 256)
Name: NF11818_low_17
Description: NF11818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11818_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 122 - 246
Target Start/End: Complemental strand, 7108062 - 7107937
Alignment:
| Q |
122 |
atcatatttgttgaattatcaggtgctatgatgaccattgaaattgctcgtagcagag-tttatcaaatttttggtcggagacagattctatgcttatcc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108062 |
atcatatttgttgaattatcaggtgctatgatgaccattgaaattggtcatagcagaggtttgtcaaatttttggtcggagacagattctatgcttatcc |
7107963 |
T |
 |
| Q |
221 |
ttcttgccttcaagtccatttctctg |
246 |
Q |
| |
|
|| ||||||||||||||||||||||| |
|
|
| T |
7107962 |
tttttgccttcaagtccatttctctg |
7107937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 19 - 122
Target Start/End: Complemental strand, 7108342 - 7108239
Alignment:
| Q |
19 |
gttaaggtctagagttttaaaaaacgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgagtataatcttgtcatattt |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108342 |
gttaaggtctagagttttaaaaaatgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgagtataatcttgtcatattt |
7108243 |
T |
 |
| Q |
119 |
ctta |
122 |
Q |
| |
|
|||| |
|
|
| T |
7108242 |
ctta |
7108239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University