View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11819_high_14 (Length: 357)
Name: NF11819_high_14
Description: NF11819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11819_high_14 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 157 - 341
Target Start/End: Complemental strand, 45728060 - 45727876
Alignment:
| Q |
157 |
cttacttgattctcatgttgggctcttaaccgcccaacacaaattaaaaaataaatattgcgcaatatatttttctatttccgtgttttaattgtttctc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45728060 |
cttacttgattctcatgttgggctcttaaccgcccaacacaaattaaaaaataaatattgcgcaatatatttttctatttccgtgttttaattgtttctc |
45727961 |
T |
|
| Q |
257 |
gcagtctcgatactcgctcaaactaccttcttcttcttagttctcttccaactcacttgagcctaacccttctacgttctcttct |
341 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45727960 |
gcactctcgatactcgctcaaactaccttcttcttcatagttctcttccaactcacttgagcctaacccttctacgttctcttct |
45727876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 45728627 - 45728460
Alignment:
| Q |
1 |
cgacccacgttcaacattctcattcttattcttttttgaatgtgatggtgaagatctcttccggcttaaatactagag-ttcttaatttgaattcactca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45728627 |
cgacccacgttcaacattctcattcttattcttttttgaatgtgatggtgaagatctcttccggcttaaatactggagattcttaatttgaattcactca |
45728528 |
T |
|
| Q |
100 |
taagtatcaagtatgtgtatgtagcaggtaagggagagttttgttgcatagtgccgtcttacttgattc |
168 |
Q |
| |
|
|||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45728527 |
taagcat-aagtatgtgtatgtagcaggtaagggagagttttgttgcatagtgccatcttacttgattc |
45728460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 281 - 342
Target Start/End: Complemental strand, 45734417 - 45734356
Alignment:
| Q |
281 |
accttcttcttcttagttctcttccaactcacttgagcctaacccttctacgttctcttctc |
342 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
45734417 |
accttcttcttctcagttctcttccaactcacttgaacctaacccttctatgttctcttctc |
45734356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 157 - 196
Target Start/End: Complemental strand, 82635 - 82597
Alignment:
| Q |
157 |
cttacttgattctcatgttgggctcttaaccgcccaacac |
196 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
82635 |
cttacttgattctcatgtt-ggctcttaaccgcccaacac |
82597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 157 - 196
Target Start/End: Complemental strand, 18125089 - 18125051
Alignment:
| Q |
157 |
cttacttgattctcatgttgggctcttaaccgcccaacac |
196 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18125089 |
cttacttgattctcatgtt-ggctcttaaccgcccaacac |
18125051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 160 - 196
Target Start/End: Complemental strand, 30031167 - 30031132
Alignment:
| Q |
160 |
acttgattctcatgttgggctcttaaccgcccaacac |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30031167 |
acttgattctcatgttgg-ctcttaaccgcccaacac |
30031132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University