View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11819_low_31 (Length: 239)
Name: NF11819_low_31
Description: NF11819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11819_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 7 - 224
Target Start/End: Complemental strand, 55405983 - 55405761
Alignment:
| Q |
7 |
attctaataccaaaacagcctttgttccaatgctaaagtaaatttcttttacctgaacttgatttacaagagtggaagtgaa-----gtgaattgaatgt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
55405983 |
attctaataccaaaacagcctttgttccaatgttaaagtaaatttcttttacctgaacttgatttacaagagtggaagtatattcacgtgaattgaatgt |
55405884 |
T |
 |
| Q |
102 |
gaacaatcgtgaactctgaaatctattgtaaacaacagcttgccattaaccatagatgtgttttgtgtcttgaacgtgcattaaaaattcaaagtaatca |
201 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
55405883 |
gaacaatcgtgaactctgaaatctaatgtaaacaacagcttgccattaaccatagatgtgttttgtgtcttgagcgtgcattaaaaattcaaagtaatca |
55405784 |
T |
 |
| Q |
202 |
atggatttgacagaggttaatac |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
55405783 |
atggatttgacagaggttaatac |
55405761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University