View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11819_low_32 (Length: 239)
Name: NF11819_low_32
Description: NF11819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11819_low_32 |
 | |
|
| [»] scaffold0110 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 94 - 226
Target Start/End: Complemental strand, 30036410 - 30036281
Alignment:
| Q |
94 |
caaattctatgacaaattcaatccaaaatcagaagccnnnnnnnnnnnnatgattaagaacaccaattggattcagtttaattcaggttatttctctgtg |
193 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30036410 |
caaattctaagacaaattcaatccaaaatcagaagccttttttttt---atcattaagaacaccaattggattcagtttaattcaggttatttctctgtg |
30036314 |
T |
|
| Q |
194 |
caaattgcaatcagcttcccagtgccttatcct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30036313 |
caaattgcaatcagcttcccagtgccttatcct |
30036281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 94 - 226
Target Start/End: Complemental strand, 30152146 - 30152017
Alignment:
| Q |
94 |
caaattctatgacaaattcaatccaaaatcagaagccnnnnnnnnnnnnatgattaagaacaccaattggattcagtttaattcaggttatttctctgtg |
193 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30152146 |
caaattctaagacaaattcaatccaaaatcagaagccttttttttt---atcattaagaacaccaattggattcagtttaattcaggttatttctctgtg |
30152050 |
T |
|
| Q |
194 |
caaattgcaatcagcttcccagtgccttatcct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30152049 |
caaattgcaatcagcttcccagtgccttatcct |
30152017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 146 - 224
Target Start/End: Original strand, 41410 - 41488
Alignment:
| Q |
146 |
attaagaacaccaattggattcagtttaattcaggttatttctctgtgcaaattgcaatcagcttcccagtgccttatc |
224 |
Q |
| |
|
||||| ||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41410 |
attaacaacaccaattggattcacttcacttcaggttatttctctgtgcaaattgcaatcagcttcccagtgccttatc |
41488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 41061 - 41108
Alignment:
| Q |
19 |
taatgtctttctttggtatgatgccctctatgttcctcggatccttat |
66 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| | |||||||| |
|
|
| T |
41061 |
taatgtctttcttttgtatgatgccctctatgttccttgaatccttat |
41108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University