View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11819_low_34 (Length: 213)
Name: NF11819_low_34
Description: NF11819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11819_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 88 - 198
Target Start/End: Original strand, 13635167 - 13635277
Alignment:
| Q |
88 |
gatacttacatgcgcatggtttgctttaaaccctcttcttcgagatattgatgaacgagtagaagcaattctttgtacagagctgacatttttgagctga |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13635167 |
gatacttacatgcgcatggtttgctttaaaccctcttcgtcaagatattgatgaacgagtagaagcaattctttgtacagagctgacatttttgagctca |
13635266 |
T |
|
| Q |
188 |
agagagaaatg |
198 |
Q |
| |
|
||||||||||| |
|
|
| T |
13635267 |
agagagaaatg |
13635277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 180
Target Start/End: Complemental strand, 27531897 - 27531800
Alignment:
| Q |
88 |
gatacttacatgcgcatggtttgct-----ttaaaccctcttcttcgagatattgatgaacgagtagaagcaattctttgtacagagctgacattttt |
180 |
Q |
| |
|
|||| ||||||||||||||||| || ||||||||||||| || |||||||||||||||| ||| | |||||| |||| || | ||||||||||| |
|
|
| T |
27531897 |
gatatttacatgcgcatggtttccttcaaattaaaccctcttcctcaagatattgatgaacgattagcatcaattccttgttcaaatctgacattttt |
27531800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 13125349 - 13125415
Alignment:
| Q |
1 |
taaaccaataccaaaatcaacacaaaactaactaaatagtaataattaacaacaataattagattgt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13125349 |
taaaccaataccaaaatcaacacaaaactaaccaaatagtaataattaacaacaataattagattgt |
13125415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University