View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11821_low_12 (Length: 404)
Name: NF11821_low_12
Description: NF11821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11821_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 169 - 389
Target Start/End: Original strand, 17771057 - 17771284
Alignment:
| Q |
169 |
tgttgggacggacagcgatggctttctgcagggtgctggttggttttggannnnnnnnnnn-------acagcggcgtggttgagtagtagggctaggcg |
261 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||||||| | |
|
|
| T |
17771057 |
tgttgggacggacaacgatggctttctgcagggtgctggttggttttggtttttttttttttttttttacagcggcatggctgagtagtagggctaggtg |
17771156 |
T |
 |
| Q |
262 |
tgtctgagtttaggaggtgaggcagaggtatccctttaggaggtgaggcaggagatctcctttgaaaatataagcttcatgctcaatgtgagaagtaaaa |
361 |
Q |
| |
|
||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17771157 |
tgtctaagtttaggaggtaaggcaggggtatccctttaggaggtgaggcaggagatctcctttgaaaatataagcttcatgctcaatgtgagaagtaaaa |
17771256 |
T |
 |
| Q |
362 |
gcagcatcaattccactctcaaagactg |
389 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
17771257 |
gcagcatcaattccactctcaaagactg |
17771284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 17770889 - 17770993
Alignment:
| Q |
1 |
tgatttatataacagaaagaaaggatgtggtaaaacagaaagttgaaacaattaatgataaatggtgtctttttgagcttgtaaccttttgatttcggct |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17770889 |
tgatttatataaaagaaagaaaggatgtggtaaaatagaaagttgaaacaaataatgataaatggtgtctttttgagcttgtaaccttttgatttcggct |
17770988 |
T |
 |
| Q |
101 |
gacag |
105 |
Q |
| |
|
||||| |
|
|
| T |
17770989 |
gacag |
17770993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 41066764 - 41066821
Alignment:
| Q |
1 |
tgatttatataacagaaagaaaggatgtggtaaaacagaaagttgaaacaattaatga |
58 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
41066764 |
tgatttatataaaagaaagaaaggatgttgtaaaacagaaagttgggacaattaatga |
41066821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University