View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11821_low_22 (Length: 324)
Name: NF11821_low_22
Description: NF11821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11821_low_22 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 13 - 324
Target Start/End: Original strand, 32817501 - 32817809
Alignment:
| Q |
13 |
agatggtgctctttgcagcttcttaggatgaacaaaatcactattggaggatggtttacttgctgatgaatccttcaaaagttctgagctgattagtctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32817501 |
agatggtgctctttgcagcttcttaggatgaacaaaatcactattgga---tggtttacttgctgatgaatccttcaaaagttctgagctgattagtctt |
32817597 |
T |
|
| Q |
113 |
gttgaagggtaaggatcagaatgacaccttaacatctttggttttatatttaacaagttatcaaaataccaacactcttcaagtagattcattgcttcca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32817598 |
gttgaagggtaaggatcagaatgacaccttaacatctttggttttatatttaacaagttatcaaaataccaacactcttcaagtagattcattgcttcca |
32817697 |
T |
|
| Q |
213 |
ctttttcatctttgcaaaaagaagattcacaagagctattattatcatttggatccatgtgtttcaacttttctaactttttcacccttacatgtatgta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32817698 |
ctttttcatctttgcaaaaagaagattcacaagagctattattatcatttggatccatgtgtttcaacttttctaactttttcacccttacatgtatgta |
32817797 |
T |
|
| Q |
313 |
tgtatgtatgta |
324 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32817798 |
tgtatgtatgta |
32817809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University