View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11821_low_30 (Length: 251)
Name: NF11821_low_30
Description: NF11821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11821_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 10 - 107
Target Start/End: Complemental strand, 32671190 - 32671095
Alignment:
| Q |
10 |
gcagagagttattatgcatgctttagcatatattatgtgagaaatattgtttgcatggaaaaggaaacaaacacatccaaacaagcacgcctaagaaa |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32671190 |
gcagagagttattatgcatggcttagcatat--tatgtgagaaatattgtttgcatggaaaaggaaacaaacacatccaaacaagcacgcctaagaaa |
32671095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 175 - 228
Target Start/End: Original strand, 32672244 - 32672297
Alignment:
| Q |
175 |
ctcatgtaaggggatggaatgataatgaactatttattgtcaaaagtattaaga |
228 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32672244 |
ctcatgtaaggggatggaatgatcatgaactatttattgtcaaaagtattaaga |
32672297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 105 - 161
Target Start/End: Original strand, 32672164 - 32672219
Alignment:
| Q |
105 |
aaacatagatgatcaatattttagttactcttcacaactcatgtaaggggatttact |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32672164 |
aaacatagatgatcaatattt-agttactcttcacaactcatgtaaggggatttact |
32672219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 105 - 149
Target Start/End: Complemental strand, 32671020 - 32670976
Alignment:
| Q |
105 |
aaacatagatgatcaatattttagttactcttcacaactcatgta |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32671020 |
aaacatagatgatcaatattttagttactcttcacaactcatgta |
32670976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University