View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11821_low_33 (Length: 242)
Name: NF11821_low_33
Description: NF11821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11821_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 35067952 - 35068177
Alignment:
| Q |
1 |
gccttgaagtctcttccttcggagagaggggaggtgggggtggtggatggccttaaactccgtggctggctttaaactccctccctctatgctacaatta |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
35067952 |
gccttgaagtctcttcctccggagagaggggaagtgggggtggtggatggccttaaactccgtggttggccttaaactccctccctctatgctacaatta |
35068051 |
T |
|
| Q |
101 |
cttgcccgaagctcagcgagctcatcaacatctaacatcgcagggactataggacacgaacatccttcatccgtaggtacaatatcacttgaacatcctt |
200 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
35068052 |
cttgccagatgctcagcgagctcatcaacatctaacatcgcagggactgtaggacacgaacatccttcatctgttggtacaatatcacttgaacatcctt |
35068151 |
T |
|
| Q |
201 |
ccaccaaactacatttagtagctagc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35068152 |
ccaccaaactacatttagtagctagc |
35068177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University