View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11822_high_7 (Length: 353)
Name: NF11822_high_7
Description: NF11822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11822_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 23 - 142
Target Start/End: Complemental strand, 39237406 - 39237287
Alignment:
| Q |
23 |
atatctagtgttcaaataattttacgaaattaattttgnnnnnnnctcctcaggtcaggtgatgcagagattgttgctgacgttgagacactgaagtagg |
122 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39237406 |
atatctggtgttcaaataattttacgaaattaattttgtttttttctcctcaggtcaggtgatgcagagattgttgctgacgttgagacactgaagtaag |
39237307 |
T |
 |
| Q |
123 |
gatcaggctaagtatgatat |
142 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39237306 |
gatcaggctaagtatgatat |
39237287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 39237218 - 39237175
Alignment:
| Q |
207 |
cttagaaaatccattgatcatgtagaattttcttttttaccccg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39237218 |
cttagaaaatccattgatcatgtagaattttcttttttaccccg |
39237175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University