View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11822_low_12 (Length: 260)

Name: NF11822_low_12
Description: NF11822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11822_low_12
NF11822_low_12
[»] chr2 (2 HSPs)
chr2 (15-108)||(5174657-5174754)
chr2 (198-240)||(5174608-5174650)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 15 - 108
Target Start/End: Complemental strand, 5174754 - 5174657
Alignment:
15 cagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatg----catgagttagataaatgttcattttacatatg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||| |||||    
5174754 cagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatgcatgcatgagttagataaatgttcattttaaatatg 5174657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 198 - 240
Target Start/End: Complemental strand, 5174650 - 5174608
Alignment:
198 tattattgtctacttgctccaattattaacagcaacatatctt 240  Q
    |||||||||||||||||||||||||||||||||||||||||||    
5174650 tattattgtctacttgctccaattattaacagcaacatatctt 5174608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University