View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11822_low_6 (Length: 413)
Name: NF11822_low_6
Description: NF11822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11822_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 241
Target Start/End: Complemental strand, 29814069 - 29813847
Alignment:
| Q |
14 |
agatgaaacaacggataatttaatgaaaattttcatgttgtcgtgttatttgaaaattttatgtatacttttctctacaaataatatctaacttttgata |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
29814069 |
agatgaaacaaaggataatttaatgaaaattttcatgttgtcgtgttatttgaaaattttatgta--cttttctctacaaata---tctaacttttgata |
29813975 |
T |
|
| Q |
114 |
gtaaatttttgctgatcaatataaagaaaacatgaatacaaagtttttacatgataataataaccgtatacaaatttacttttaactacgtactttcgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29813974 |
gtaaatttttgctgatcaatataaagaaaacatgaatacaaagtttttacatgataataataactgtatacaaatttacttttaactacgtactttcgtt |
29813875 |
T |
|
| Q |
214 |
aacatgattgtgcatgcagcatgtgtca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29813874 |
aacatgattgtgcatgcagcatgtgtca |
29813847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 306 - 396
Target Start/End: Complemental strand, 29813781 - 29813691
Alignment:
| Q |
306 |
gttcaggtaggggctgcattctttgtttcgtaacgttgttatctcgttggtcctacggttagtacaaccgtttatttaaccataataacat |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29813781 |
gttcaggtaggggctgcattctttgtttcgtaacgttgttatctcgttggtcctacggttagcacaaccgtttatttaaccataataacat |
29813691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University