View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11822_low_8 (Length: 353)

Name: NF11822_low_8
Description: NF11822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11822_low_8
NF11822_low_8
[»] chr5 (2 HSPs)
chr5 (23-142)||(39237287-39237406)
chr5 (207-250)||(39237175-39237218)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 23 - 142
Target Start/End: Complemental strand, 39237406 - 39237287
Alignment:
23 atatctagtgttcaaataattttacgaaattaattttgnnnnnnnctcctcaggtcaggtgatgcagagattgttgctgacgttgagacactgaagtagg 122  Q
    |||||| |||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
39237406 atatctggtgttcaaataattttacgaaattaattttgtttttttctcctcaggtcaggtgatgcagagattgttgctgacgttgagacactgaagtaag 39237307  T
123 gatcaggctaagtatgatat 142  Q
    ||||||||||||||||||||    
39237306 gatcaggctaagtatgatat 39237287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 207 - 250
Target Start/End: Complemental strand, 39237218 - 39237175
Alignment:
207 cttagaaaatccattgatcatgtagaattttcttttttaccccg 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
39237218 cttagaaaatccattgatcatgtagaattttcttttttaccccg 39237175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University