View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11822_low_9 (Length: 345)
Name: NF11822_low_9
Description: NF11822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11822_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 48159481 - 48159229
Alignment:
| Q |
1 |
agtaagtaagtaagttttattcattctttgtatttctcatagtgaaaaatgtc-aaatttccattttgacagatattagaaaatggggtgaataggatgc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48159481 |
agtaagtaagtaagttttattcattctttgtatttctcatagtgaaaaatgtctaaatttccattttcacagatattagaaaatggggtgaataggatgc |
48159382 |
T |
|
| Q |
100 |
ttgttgttcttgaagattggagaaattcacgcataatccaattagttgccatactggtttctattttaatgattgttccatcagctgatgctgttgatgc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159381 |
ttgttgttcttgaagattggagaaattcacgcataatccaattagttgccatactggtttctattttaatgattgttccatcagctgatgctgttgatgc |
48159282 |
T |
|
| Q |
200 |
actcaaaacttgtgcttgtttgctcaaggaatgcaggtatgctactataccac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48159281 |
actcaaaacttgtgcttgtttgctcaaggaatgcaggtatgctgctataccac |
48159229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 264 - 332
Target Start/End: Complemental strand, 48159204 - 48159136
Alignment:
| Q |
264 |
ttgccaaatgttagtagcagagattcaactctaaaccacctacatataactctttaggtgtccccgcct |
332 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48159204 |
ttgccaaatgttagtagcagatattcaactctaaaccacctacatataactctttaggtgtccctgcct |
48159136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University